.. Basic usage of BarNone script Usage =================================== BarNone is usually used directly as a script, with the following options: .. program-output:: BarNone -h .. Options ------- Read Composition ~~~~~~~~~~~~~~~~ All within-read positions are indexed starting at 1. -s START, --start START Start position of barcode -l LENGTH, --length LENGTH Length of barcode. If shorter barcodes exist in the catalog, those substrings (starting from the beginning of the read) will also be checked. --uptag UPTAG Sequence designating an up-tag. --downtag Input ----- Two files are used for input: one containing the sequencing results, and another containing the barcode catalog file. The sequencing file can be in any of the following formats: * `fastq `_ * `fasta `_ * `qseq `_ * Raw text: one read per line. The barcode catalog file should be tab-delimited, with content analogous to:: YBL103C AGTCTACCCACATGCTTTAG ATTCATAGGACACTTGCCGG YBL104C ACTCATCAGGTATGGGAACG AATTCTAGCGCATGGTCCGG YBL105C AGTGCTAATACGGCATAACG ACACTACCTAGATGGAGCGG Each line has three components: a unique identifier for the gene, an uptag sequence, and a downtag sequence. The uptag and downtag sequences are each optional; if one is missing, it will be counted as having 0 reads in the output. Output ------ Counts ~~~~~~ BarNone produces a tab-delimited file describing the number of reads that matched to each barcode. If the file was not multiplexed, the output counts file has three columns, such as:: YAL008W 352 0 YBR255W 505 1411 YGR164W 429 1255 This describes, for each strain, how many up and down barcodes (respectively) were found. If the file was multiplexed using the :command:`--multiplexfile` option, the counts file contains two columns for each multiplexing barcode, and a header row describing each. For example:: Strain Sample1|UP Sample1|DOWN Sample2|UP Sample2|DOWN Sample3|UP Sample3|DOWN YAL008W 352 0 471 0 478 0 YBR255W 505 1411 724 1319 754 1476 YGR164W 429 1255 608 1594 596 1495 Revised Barcode Catalog ~~~~~~~~~~~~~~~~~~~~~~~ BarNone is capable of constructing a new barcode catalog based on common mismatches found in a sequencing file. If a mismatched version of a barcode is found more frequently than the original, BarNone replaces that barcode with the more common version. This is specified using the :command:`--revisedcatalog` option. Mismatches ~~~~~~~~~~ One can also obtain a much more detailed report about the specific mismatches using the :command:`--mismatchfile` option. The specified file will be written in a format analogous to:: YOR041C ACATCCCGATCAGGTGACTG 23215 ACATCCCGATCAGGCGACTG (62)/CCATCCCGATCAGGTGACTG (34)/ACATCCCGATCAGNTGACTG (33) YEL008W GCATCACAGCAATGGGCATA 2989 GCATCACAGCACTGGGCATA (20)/GCATCACAGCAACGGGCATA (8)/GCATCACAGCAATGGGCATC (8) YMR011W GCCTCACTTAAAGCATACGA 6140 GCCTCACTTAACGCATACGA (33)/ACCTCACTTAAAGCATACGA (14)/GCATCACTTAAAGCATACGA (11) YDR440W GCGGCCCTACAATTTATGAA 17 CCGGCCCTACAATTTATGAA (27840)/CCGGCCCTACACTTTATGAA (52)/ACGGCCCTACAATTTATGAA (46) Each line contains the name of the strain, the original barcode, the number of times the original barcode appeared in the reads, and then a slash-delimited list of the close barcodes that were matched with the number of times each of them occured. Of these four barcodes, YDR440W has a close match that is much more common than its original barcode, meaning that it would be replaced in a revised catalog. Examples -------- Nutrient Starvation Data ~~~~~~~~~~~~~~~~~~~~~~~~ Using the Gresham et al 2011 nutrient starvation data available `here `_ (in this example, the file `Expt10.txt `_), would require a command like:: BarNone -f fastq -m 2 Expt10.txt counts.txt barcode_catalog.txt This would match all barcodes in the file to a matching read in the catalog within an edit distance of 2 (set by the ``-m`` option). An example of such a barcode catalog file is available in the :file:`examples/smith_et_al_2009_barcodes.txt`.